Saturday, June 22, 2019
Gene Analysis Essay Example | Topics and Well Written Essays - 1000 words
Gene Analysis - Essay ExampleGene therapy, integrating vectors carrying therapeutic trans agent sequences offers the potential for a permanent cure of elementtic diseases by stable vector insertion into the patients chromosomes (1). However there are some reports indicating occurrence of tumors at later stage in transgenic animal and thats why it is of import to know probability of non specific integration of this transgene and its effect on cellular homeostasis. As per the present understanding the integration is semi-random in nature and having checkial penchant towards sequences in or near the coding regions of expressed genes (1). Integration in these places may lead to up or down regulation of that particular gene and hence increase the probability of interference in cellular homeostasis. Based on above observations, it is highly recommended to verify the insertion loci of presumptuousness vectors in regulate system. Based on bio-informatical analysis of given sequence, we were able to demonstrated that Viral vector integrates in vicinity to gene called Nfib (Nuclear factor I/B) and interferes with it normal functioning. expand investigation and database search indicates Nfib has potential role in cell cycle regulation and oncogenesis.Vectors, transfection, cloning, amplification and sequencing were performed as per previously mention protocol (1). For identification of gene and its functionality sequence was BLAST against the Mouse genome database (http//www.ncbi.nlm.nih.gov/genome/seq/BlastGen/BlastGen.cgitaxid=10090). Similarly for further verification, sequence was BLAT (http//genome.brc.mcw.edu/cgi-bin/hgBlat) and also compared in RTCGD (http//rtcgd.abcc.ncifcrf.gov/). , to investigate presence of similar gene entry in the data base.GeneSequence 5AAAAATGGTATATATAGAGTCTTGTCTTTGGTGACTAGGAAAAGTCAGTAAAGGAATGAATAATAAA AGACAGCCAGTTGAAGGAAGATTTTTTTTTTTCAATT 3Results and discussion The sequence was used for similarity search by BLAST in mouse genome d atabase. All the default parameters were kept without changing for identification of match. Fig 1 shows results obtained after BLAST of given sequence.FIG 1 BLAST resultsrefNT_039260.7Mm4_39300_37 Mus musculus chromosome 4 genomic contig, strain C57BL/6JLength=28591323 Features in this part of subject sequence nuclear factor I/B Score = 191 bits (103), Expect = 1e-46 Identities = 103/103 (100%), Gaps = 0/103 (0%) Strand=Plus/PlusQuery 2 AAAATGGTATATATAGAGTCTTGTCTTTGGTGACTAGGAAAAGTCAGTAAAGGAATGAAT 61 Sbjct 21590158 AAAATGGTATATATAGAGTCTTGTCTTTGGTGACTAGGAAAAGTCAGTAAAGGAATGAAT 21590217Query 62 AATAAAAGACAGCCAGTTGAAGGAAGAtttttttttttCAATT 104Sbjct 21590218 AATAAAAGACAGCCAGTTGAAGGAAGATTTTTTTTTTTCAATT 21590260 As seen above, 100% matching were obtained with very low E values (1e-46) which clearly indicates the given sequence belongs to gene called nfib (Nuclear factor I/B). It is located on chromosome 4 (Chr481761404-82176981 bp, - strand). Nfib is member of protein family having diverged role in transcription and cell cycle regulation.Similarly BLAT analysis retrieves same gene against the query of given sequence.
Subscribe to:
Post Comments (Atom)
No comments:
Post a Comment
Note: Only a member of this blog may post a comment.